Family with Member 200 C (FAM200C) is a protein, which in humans is encoded by the FAM200C gene. The primary aliases of the gene are ZBED8, C5orf54, and Buster3.
Gene In the human genome, FAM200C is located on the minus strand of chromosome 5, at 5q33.3. FAM200C can be transcribed into 2 different transcript variants, which contain 3 and 2 exons, respectively.
Expression FAM200C is expressed ubiquitously and variably in human tissues, with a 10-fold difference between the lowest and highest expression values (~0.23-2.3). FAM200C has the highest tissue expression in the ovaries, followed by the endometrium, thyroid, testis, and prostate.
mRNA FAM200C mRNA has 2 transcript variants. FAM200C Variant 1 is the longest in terms of nucleotide length, spanning 2,882 nucleotides. +FAM200C Transcript VariantsTranscript VariantVariant Length (nt)Accession NumberProteinProtein Length (aa)FAM200C Variant 12,882NM_001303251.2NP_001290180.1594FAM200C Variant 22,808NM_022090.5NP_071373.2594
Protein The Family with Sequence Similarity 200 Member C protein in Homo sapiens is encoded by the FAM200C gene. Protein FAM200C has a predicted molecular weight of 68326.71 Da, with a theoretical isoelectric point of 5.98. The protein is localized to the Nucleoplasm.
Promoter Using UCSC's Genome Browser, a promoter region sequence was found. The most likely promoter region for FAM200C starts at 160,399,954 and goes to 160,400,554, with a length of 601 base pairs.
Protein interactions +FAM200C Predicted Functional Partners from STRINGProteinFull NameDescriptionScoreMETTL21AMethyltransferase 21A, HSPA LysineEnables ATPase binding activity, Hsp70 protein binding activity, and protein-lysine N-methyltransferase activityMETTL21A – methyltransferase 21A, HSPA lysine. NCBI Gene 151194.0.732PGBD2PiggyBac transposable element derived 2Protein-coding gene, that interacts directly with DNA.PGBD2 – piggyBac transposable element derived 2. NCBI Gene 267002.0.692THAP9THAP domain containing 9Enables sequence-specific DNA binding activity and transposase activity.THAP9 – THAP domain containing 9. NCBI Gene 79725. Alliance of Genome Resources HGNC:231920.586GIN1Gypsy retrotransposon integrase 1Predicted to enable nucleic acid binding activity.GIN1 – gypsy retrotransposon integrase 1. NCBI Gene 54826. Alliance of Genome Resources HGNC:259590.541CRLF3Cytokine receptor like factor 3Encodes a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase.CRLF3 – cytokine receptor like factor 3. NCBI Gene 51379.0.505ZNF862Zinc finger protein 862Predicted to enable protein dimerization activity and zinc ion binding activity.ZNF862 – zinc finger protein 862. NCBI Gene 643641. Alliance of Genome Resources HGNC:345190.501POGKPogo transposable element derived with KRAB domainContains a KRAB domain at the N-terminus and a transposase domain at the C-terminus.POGK – pogo transposable element derived with KRAB domain. NCBI Gene 57645.0.499PGBD1PiggyBac transposable element derived 1Belongs to the subfamily of piggyBac transposable element derived genes; expressed in the brain.PGBD1 – piggyBac transposable element derived 1. NCBI Gene 84547.0.489PGBD5PiggyBac transposable element derived 5Belongs to the subfamily of piggyBac transposable element derived genes.PGBD5 — piggyBac transposable element derived 5. NCBI Gene 79605.0.477NAIF1Nuclear apoptosis inducing factor 1Predicted to be involved in negative regulation of cell growth and regulation of mitochondrial membrane permeability involved in apoptotic process.NAIF1 – nuclear apoptosis inducing factor 1. NCBI Gene 203245. Alliance of Genome Resources HGNC:254460.460
Structure
Secondary structure The figure "FAM200C Predicted Secondary Structure" 1 and 2 provide a Phyre2.2 model prediction of FAM200C's secondary structure. Model indicates secondary structure is predicted to be composed of 9% disordered, 45% alpha helices, and 8% beta strands.
Tertiary structure FAM200C tertiary structure predictions available through Phyre2.2 and AlphaFold.
Gene ontology The figure titled "FAM200C Mature miRNA Sequences by Target Score" shows the 8 mature miRNA sequences for FAM200C available through text mining. +FAM200C Mature miRNA Sequences by Target ScoremiRNA NameTarget ScoreSeed LocationmiRNA Sequencehsa-miR-767-5p76291UGCACCAUGGUUGUCUGAGCAUGhsa-miR-627-3p73171, 321UCUUUUCUUUGAGACUCACUhsa-miR-550a-3p70454UGUCUUACUCCCUCAGGCACAUhsa-miR-4524a-3p6564UGAGACAGGCUUAUGCUGCUAUhsa-miR-942-5p62326UCUUCUCUGUUUUGGCCAUGUGhsa-miR-449c-5p60188UAGGCAGUGUAUUGCUAGCGGCUGUhsa-miR-34b-5p60188UAGGCAGUGUCAUUAGCUGAUUGhsa-miR-376c-3p6095AACAUAGAGGAAAUUCCACGU
Evolutionary history FAM200C first arose around 94 million years ago. FAM200C is part of the Ribonuclease H-like superfamily. A Swedish University for Agricultural Sciences research team led by Dr.Alexander Hayward and Dr.Awaisa Ghazal, studying the evolutionary origins of the ZBED genes published a paper in PLOS one, reporting that: "ZBED proteins, such as C5ORF54, or ZBED8, originated from domesticated hAT DNA transposons and encode regulatory proteins with diverse, fundamental functions in vertebrates."
Orthologs FAM200C orthologs were found exclusively in mammals. The most distantly related ortholog, Talpa occidentalis, has two transcript variants. +Orthologs of FAM200C protein in order of increasing divergence from Homo sapiensTaxonomic ClassTaxonomic OrderGenus and SpeciesCommon NameDate of Divergence (MYA)Accession NumberSequence Length (aa)Sequence Identity (%)Sequence Similarity (%)MammaliaPrimatesHomo sapiensHuman0NP_001290180.1594100100MammaliaPrimatesGorilla gorilla gorillaGorilla8.6XP_004042980.259499100MammaliaPrimatesMacaca nemestrinaPig-tailed macaque28.8XP_001084430.15939899MammaliaPrimatesTrachypithecus francoisiFrancois' langur28.8XP_033036286.15939899MammaliaPrimatesCebus imitatorPanamanian white-faced capuchin43XP_017357604.159497100MammaliaPrimatesSaimiri boliviensisBolivian squirrel monkey43XP_074246649.163397100MammaliaPrimatesOtolemur garnettiiSmall-eared gelago74XP_012664265.159494100MammaliaArtiodactylaCamelus dromedariusArabian camel94XP_010991120.359494100MammaliaPerissodactylaEquus quaggaPlains zebra94XP_046524538.164194100MammaliaCarnivoraLeopardus geoffroyiGeoffroy's cat94XP_045358866.159494100MammaliaCarnivoraMirounga leoninaSouthern elephant seal94XP_034869533.159494100MammaliaCarnivoraZalophus californianusCalifornia sea lion94XP_027462964.163994100MammaliaCarnivoraVulpes lagopusArctic fox94XP_041602806.159394100MammaliaCarnivoraNeogale visonAmerican mink94XP_044086173.159493100MammaliaCarnivoraMustela lutreolaEuropean mink94XP_059030193.154993100MammaliaChiropteraPteronotus mesoamericanusPteronotus parnellii mesoamericanus94XP_054423860.159493100MammaliaChiropteraMolossus molossusPallas' mastiff bat94XP_036098001.159492100MammaliaEulipotyphaTalpa occidentalisIberian mole94XP_036098001.159492100
Paralogs FAM200C has 18 paralogs. Based on target % identity to FAM200C (>20%), the three most significant paralogs are FAM200A, FAM200B, and ZBED5. +FAM200C Paralogs with >20% Target IdentityNameFull NameTarget % IdentitySequence Length (aa)Accession NumberLocationFAM200AFamily with Sequence Similarity 200 Member A29.49573ENSG000002219097:99,546,300-99,559,392:-1FAM200BFamily with Sequence Similarity 200 Member B29.70657ENSG000002377654:15,681,506-15,690,447:1ZBED5Zinc Finger BED-type Containing 527.13693ENSG0000023628711:10,812,074-10,858,796:-1
Multiple sequence alignment The figure titled "Snippet of FAM200C Orthologs Multiple Sequence Alignment" shows a snippet of the multiple sequence alignment for FAM200C orthologs. This snippet represents the conservation of FAM200C as most of the sequence is conserved.
Protein divergence As shown in the figure titled "Informational context of FAM200C human protein...", the human FAM200C protein, is evolving slowly over time in comparison to both Fibrinogen Alpha and Cytochrome C.
Conceptual translation The figure titled "Conceptual Translation for FAM200C" shows the conceptual translation (full mRNA and amino acid sequence) of the human FAM200C transcript variant 1 showing exon boundaries, domains/motifs, polyadenylation sites, and phosphorylation sites, and a legend.
Single nucleotide polymorphisms There are 3734 single nucleotide polymorphisms catalogued in NCBI's Variation Viewer, only one of which has a clinical significance record. The only clinically significant single nucleotide polymorphism found, rs61740683, is a synonymous, single nucleotide variant with benign clinical significance.
Clinical significance FAM200C promoter could have a dual function as it starts transcription for the FAM200C gene and also an enhancer for the gene miR-146a. In a 2023 study published to the Arthritis and Rheumatology Journal for the American College of Rheumatology, researchers Xinyi Zhu, et al. discovered that when the FAM200C gene was knocked down, the expression levels for miR-146a were unaffected. This suggests that the promoter regions could also function as enhancers and regulate the expression of genes in close proximity. FAM200C is also a potential biomarker for Sarcoidosis. In a 2020 study published to the Medical Science Monitor, Min Zhao et al. identified FAM200C as a "SARC-only DEG". The researchers found that FAM200C is up-regulated in Sarcoidosis, meaning there is increased gene expression in patients with Sarcoidosis compared to patients with Pulmonary Tuberculosis and healthy control patients.
Text-based information
References